Friday, April 13, 2012

Week 1 Blog Post: Part A. Cultural Descriptions.

Extreme:  The part about the holy-mouth-man jabbing an awl into an exposed nerve made me cringe. That is definitely something that we wouldn't do here...well, unless you're at the dentist. It doesn't mean its completely barbaric. It just isn't up to what we do. Also, the thing about women baking their heads in an oven is a little strange.

Similar: The daily body ritual of the mouth-rite sounds a lot like some kind of weird teeth brushing to me. I think that we probably do some things similar, but just in different ways. They don't have crest and oral-b selling toothbrushes and toothpaste in their area. So maybe this is some kind of alternative? Going back to the thing about women baking their heads in an oven for an hour...it's like a day at the salon...kind of.

Primitive: Their healing rituals seem to be very primitive. Like I said in the last paragraph, they don't have the same luxuries that we have so it's like they're just working with what they have and what they know. They don't have a yale trained physician with an ample supply of medical necessities. They're working with what they've got and what has "worked" (or worked well enough) for hundreds of years for them.

Modest: The article mentions how these people do a lot of things in private and seem to be ashamed of some. Being pregnant, naked or anything having to do with the "restroom" they do in secret on their own. A lot of the time when you think of another culture that is not very "westernized" you think of them running around as savage animals just doing everything out in the open. These people seem to be the opposite of that.

Religious: The article states that each family has at least one shrine. I would think that this indicates that most have more than one and they make this a big part of their daily life. A lot of other religions do this same thing. It is interesting how that carries over to different cultures no matter what it is that you worship.



Part B


1.) As an American, I feel fine with my choice of descriptive words. I don't feel like they were too judgmental or rash.

2.) Yes, I believe that they do. I said that they were primitive. Which they are- in our society. In their world and society they are probably right up to par. I also said they were extreme for some of their rituals and customs. Compared to us, they are.

3.) For primitive I cant think of a single word I would use. But probably just "set in ways. For extreme I guess I would just say "different".

4) It would be best to approach these situations with a free and clear mind. I am in the process of studying and converting to buddhism and this assignment helped me realize that I am not bringing that aspect into all parts of my life. I should have approached this assignment at first with a 100% black mind and free slate so that I could not compare them to my own society and way of life but focus on the beauty and individuality of their ways.

Tuesday, October 11, 2011

environmental stresses


1)   The environmental stress I chose was heat.  Humans have adapted to almost every climate in the world. However, high temperatures (113F) causes the metabolism and human homeostasis to stop and will ultimately cause death. 


2)   When faced with heat stress an organism will reduce its metabolic activity so the heat in its body isn’t as high,  they decrease their energy levels,  humans in regions with higher temperatures usually have longer limbs because it allows more surface area on the body and the greater the surface area, the faster the body heat will dissipate into the environment and off our bodies, sweat also helps to cool our bodies.

3)   The benefits of studying human variation across different environmental regions would be useful to us because we could see the differences in peoples reactions in different climates. Do people in hotter climates sweat differently than people in cooler ones? What is the average limb length in a higher temperature climate verse a cooler climate? 

This would be beneficial to science so we could have a better understanding when we find fossils. We would be able to see if the limbs on those correspond with the current day adaptations and see when this started.

4)   Race could be used as a more in-depth way to categorize humans and these adaptations. I think that it wouldn’t really be super important to the whole thing. Region the person is from would be the most important thing.  If this was in the terms of fossils we do not know that race as a defined as it seems today. 

Tuesday, October 4, 2011

Body language


Part 1:

I found this part of the experiment to be fairly easy. I was engaging in conversation with my step sister. She is a big talker so it was easy to carry on a conversation without actually saying anything just nodding in agreement or shaking my head to disagree. At about the 12 minute mark she noticed I hadn’t said anything and started getting mad at me thinking I was making a joke about what she was saying, but before that – she didn’t notice that I was not verbally responding to what she was saying.  It would be hard to say who would have the advantage in communicating complex ideas. I would assume it would be the person who cannot communicate with spoken language because you could kind of act things out which even the person who spoke with language could figure out.  I used to work at the Apple Store and I once assisted someone who was deaf at first he was kind of acting things out. It took a few minutes to get on the same “page” but eventually things were okay and i got him what he was looking for.  I think that if we were making up 2 fake cultures with the same specifications of the assignment the culture that had the vocal speech would think they were superior to the culture that did not use vocal speech. They would think they were uneducated or not as advanced . My answers were kind of backwards for this section.


Part 2:

I was able to last the whole 15 minutes with only vocally communicating.  My partner wasn’t effected by it at all. I did this portion with my mom. I noticed that she uses her hands a lot to speak. I think that I noticed this a lot because I was actually paying attention to it.  I come from a really Italian family. My Italian family is always waving their hands around when they speak. I think they would go nuts if you tied their hands down while they were speaking. My mom doesn’t come from an Italian background but I think that she picked something up from my dads family because she is insane with the hand movements when talking. I am currently watching my step-dad and my mom have a conversation and he is using his hands quite a bit – not as much as my mom is. I think that in our society it’s used to express feeling and seriousness. It definitely brings something to the conversation.  If I was deaf and watching their conversation, I think I’d be able to tell the “tone” of the conversation just by watching their body language and hand movements. A lot of people have difficulty reading body language. The benefit to being able to read it would be if you were in the situation where someone was saying something to you that was “serious” but their body language showed they were joking. You would then know it was a joke and not take their statement as serious.  The environmental condition where there might be  a benefit in not reading body language would be if you were really cold and shivering.  That would probably hinder the expression of any emotion because you’d probably bundled up and shivering. 

Monday, September 19, 2011

Piltdown Hoax

1) The Piltdown Hoax is called the most famous paleontological hoax ever. It took 40 years for it to be discovered as a hoax but was held to be very controversial until then.  On December 18th, 1912 at a meeting of the Geological Society of London, Charles Dawson said he was given a fragment of a skull by a man who worked at a gravel pit in Piltdown, England. Dawson then revisited the site and found more skull fragments. Dawson took the pieces to Arthur Smith Woodward who also gained an interest in them and together the two men recovered more pieces of skull plus the lower jaw bone (mandible). Woodward put the pieces together and said that the skull resembled a modern human man but with a few differences. He suggested that the skull was the missing link between ape and man. in 1923, Franz Weidenreich examined the skull. He concluded that the main part of the skull was from a human and the mandible was from an ape or an orangutan with the teeth filed down. People didn't believe him but eventually it was proven that he was correct.

2) I think a lot of this had to do with technology at the time. If this situation happened today everything would have been DNA tested and cat scanned and all sorts of stuff. Back in that time, they had very few things they could do to verify anything. They had their scientific methods, of course. But nothing like we had today. I think the lack of technology got the better of them in this situation.

3) The scientists that examined the Piltdown subject concluded that the bones were stained with an iron and acid solution. After studying it closely with a microscope they discovered there were file marks on the teeth which they concluded someone intentionally did to give the impression of a shape more suited to the human diet. They also preformed a fluorine absorption test on the specimen, they tested as being fairly modern.


4) I think if this was completely computer analyzed in this day and age it would have been proven to be a fraud really quickly. But I definitely do not think that science should be 100% non human. That just becomes scary. I think we definitely need scientists and inventors - all those people with creative minds to step outside the box and see things from a different angle.

5) This just reenforces the need to check everything out for yourself. Make sure you get the facts, ask the important questions, double check your answers. Don't take everything at face value. Be aware of what you are taking in as a "fact"

Wednesday, September 14, 2011

Primates


Lemur


The Lemur is from the island of Madagascar. They are often said to be a link in evolution to apes and humans, but this is not true. They share morphological and behavioral traits, however. The Lemur has adapted to the harsh conditions of Madagascar very well. They can walk on two legs(bipedal) or four legs(quadrupedal). They eat a wide variety of fruit and leaves so their ability to climb is vital to their existence.  A lemurs foot looks very similar to an ape or human hand. 




 (I thought this picture was the most interesting because you could see it's bones) 
Spider Monkey


The Spider Monkey is found in the tropical forest of Central and South America. There are seven species of Spider Monkey in the genus. The Spider monkey has (freakishly) long arms and legs as well as a really long tail to help it climb (brachiation). Their tails are what they rely on for balance, unlike other monkey's that use their arms.  Like the Lemur, it's diet consists mainly of fruit. It also eats leaves, flowers and insects. The Spider Monkey's ability to climb to get it's food is what helps it survive.  One odd fact about the Spider Monkey is that they "bark". 



Baboon
The Baboon is from East Africa. They have a short tail, it does not help it in climbing.  I had a lot of trouble finding information on their locomotor patterns but a lot of the pictures I saw had them waling quadrupedal.  After studying East Africa, it looks very flat and desolate. I would imagine that the Baboon has adapted to this by being able to run fast (from animals that prey on it) and also walk for a long period of time on all four legs(quadrupedal).  A group of Baboons is called a "Congress". Pretty funny, huh?





Gibbon


The Gibbon is found in tropical and subtropical rain forests from northeast India to Indonesia, China and the islands of Sumatra, Borneo and Java.  Gibbons are widely known for their expert brachiation skills.  Brachiation is the stereotypical way that we view monkeys - swinging from branch to branch. It is said they can do it at speeds as fast as 35mph and can make leaps of up to 26 feet. They walk on their hind legs with their arms raised up for balance. They do not rely on their tails for balance. 



Chimpanzee


The Chimpanzee inhabits West and Central Africa. The Chimp's arms  are a lot longer than its legs suggesting that the chimp spends more time climbing in trees (brachiation)  than walking (bipedal). When Chimps do walk, they "knuckle walk" (quadrupedal) which allows their knuckles to support their body weight and hold them steady.  The Chimpanzee does not have a tail that it can use for balance. 






All of these primates reside in similar environments with the exception of the Baboon. The have all adapted to their environment very well. None of the primates use only one form of locomotion. They all use at least two. 










A video showing the 4th form of primate transportation....the pig. 


Thursday, September 8, 2011

Week 3: Analogy/Homolog

1) The species I chose for this assignment are dogs and cats. The domestic variety, specifically. I chose them because I could actually hands on learn in this situation as I have both a dog and a cat. The trait that I am exploring is their whiskers. Both dogs and cats have whiskers.  For cats, whiskers help them feel their way around. If it is night time they use them as feelers to see what is around them so they dont bump into anything. Their primary use, however is to help them judge wether or not they will fit through an opening. If they are trying to get away from another animal and want to dive through a hole in a fence, their whiskers will help them do so. Cats whiskers are very long and they are rooted deep in the cats face. They are not just "surface hairs". They are an integrated part of the cats body.  A dog uses their whiskers in the same way. However, in the case of my dog and cat..my dogs whiskers are a LOT shorter than my cats. His hardly come off of his face..and he is a really big dog.  This tells me that dogs are probably not as dependent on this "safety feature" as cats are. The common ancestor between dogs and cats is not known but what is verified is that after the Order Carnivora appeared it split off into two suborders - "Feliformia"-(cat like) and "Caniformia" (dog like).



Ford the Boxer

Bix...the angry cat. (He wears a pink collar because hes fabulous.) 




2) The species I have chosen for the Analogous trait comparison are frogs and ducks. Both frogs and ducks have webbed feet. Both of these animals are water animals. They rely on being able to use swimming as part of their transport and as a source of food. Being able to swim quickly is imperative to their survival. I couldn't find any link between them except for the widely known ideal that birds and reptiles are related. But a frog is not a reptile, it is an amphibian.


Thursday, September 1, 2011

DNA Sequence





TACTAAGGCCTAAGTCTGTGAAACAGACGGTTAATC


I threw in a lil color...you know...for style points (haaaaaay!)


some music for you to decode to....