1) The Piltdown Hoax is called the most famous paleontological hoax ever. It took 40 years for it to be discovered as a hoax but was held to be very controversial until then. On December 18th, 1912 at a meeting of the Geological Society of London, Charles Dawson said he was given a fragment of a skull by a man who worked at a gravel pit in Piltdown, England. Dawson then revisited the site and found more skull fragments. Dawson took the pieces to Arthur Smith Woodward who also gained an interest in them and together the two men recovered more pieces of skull plus the lower jaw bone (mandible). Woodward put the pieces together and said that the skull resembled a modern human man but with a few differences. He suggested that the skull was the missing link between ape and man. in 1923, Franz Weidenreich examined the skull. He concluded that the main part of the skull was from a human and the mandible was from an ape or an orangutan with the teeth filed down. People didn't believe him but eventually it was proven that he was correct.
2) I think a lot of this had to do with technology at the time. If this situation happened today everything would have been DNA tested and cat scanned and all sorts of stuff. Back in that time, they had very few things they could do to verify anything. They had their scientific methods, of course. But nothing like we had today. I think the lack of technology got the better of them in this situation.
3) The scientists that examined the Piltdown subject concluded that the bones were stained with an iron and acid solution. After studying it closely with a microscope they discovered there were file marks on the teeth which they concluded someone intentionally did to give the impression of a shape more suited to the human diet. They also preformed a fluorine absorption test on the specimen, they tested as being fairly modern.
4) I think if this was completely computer analyzed in this day and age it would have been proven to be a fraud really quickly. But I definitely do not think that science should be 100% non human. That just becomes scary. I think we definitely need scientists and inventors - all those people with creative minds to step outside the box and see things from a different angle.
5) This just reenforces the need to check everything out for yourself. Make sure you get the facts, ask the important questions, double check your answers. Don't take everything at face value. Be aware of what you are taking in as a "fact"
Monday, September 19, 2011
Wednesday, September 14, 2011
Primates

Lemur
The Lemur is from the island of Madagascar. They are often said to be a link in evolution to apes and humans, but this is not true. They share morphological and behavioral traits, however. The Lemur has adapted to the harsh conditions of Madagascar very well. They can walk on two legs(bipedal) or four legs(quadrupedal). They eat a wide variety of fruit and leaves so their ability to climb is vital to their existence. A lemurs foot looks very similar to an ape or human hand.
(I thought this picture was the most interesting because you could see it's bones) Spider Monkey
The Spider Monkey is found in the tropical forest of Central and South America. There are seven species of Spider Monkey in the genus. The Spider monkey has (freakishly) long arms and legs as well as a really long tail to help it climb (brachiation). Their tails are what they rely on for balance, unlike other monkey's that use their arms. Like the Lemur, it's diet consists mainly of fruit. It also eats leaves, flowers and insects. The Spider Monkey's ability to climb to get it's food is what helps it survive. One odd fact about the Spider Monkey is that they "bark".

Baboon
The Baboon is from East Africa. They have a short tail, it does not help it in climbing. I had a lot of trouble finding information on their locomotor patterns but a lot of the pictures I saw had them waling quadrupedal. After studying East Africa, it looks very flat and desolate. I would imagine that the Baboon has adapted to this by being able to run fast (from animals that prey on it) and also walk for a long period of time on all four legs(quadrupedal). A group of Baboons is called a "Congress". Pretty funny, huh?

Gibbon
The Gibbon is found in tropical and subtropical rain forests from northeast India to Indonesia, China and the islands of Sumatra, Borneo and Java. Gibbons are widely known for their expert brachiation skills. Brachiation is the stereotypical way that we view monkeys - swinging from branch to branch. It is said they can do it at speeds as fast as 35mph and can make leaps of up to 26 feet. They walk on their hind legs with their arms raised up for balance. They do not rely on their tails for balance.

Chimpanzee
The Chimpanzee inhabits West and Central Africa. The Chimp's arms are a lot longer than its legs suggesting that the chimp spends more time climbing in trees (brachiation) than walking (bipedal). When Chimps do walk, they "knuckle walk" (quadrupedal) which allows their knuckles to support their body weight and hold them steady. The Chimpanzee does not have a tail that it can use for balance.
All of these primates reside in similar environments with the exception of the Baboon. The have all adapted to their environment very well. None of the primates use only one form of locomotion. They all use at least two.
A video showing the 4th form of primate transportation....the pig.
Thursday, September 8, 2011
Week 3: Analogy/Homolog
1) The species I chose for this assignment are dogs and cats. The domestic variety, specifically. I chose them because I could actually hands on learn in this situation as I have both a dog and a cat. The trait that I am exploring is their whiskers. Both dogs and cats have whiskers. For cats, whiskers help them feel their way around. If it is night time they use them as feelers to see what is around them so they dont bump into anything. Their primary use, however is to help them judge wether or not they will fit through an opening. If they are trying to get away from another animal and want to dive through a hole in a fence, their whiskers will help them do so. Cats whiskers are very long and they are rooted deep in the cats face. They are not just "surface hairs". They are an integrated part of the cats body. A dog uses their whiskers in the same way. However, in the case of my dog and cat..my dogs whiskers are a LOT shorter than my cats. His hardly come off of his face..and he is a really big dog. This tells me that dogs are probably not as dependent on this "safety feature" as cats are. The common ancestor between dogs and cats is not known but what is verified is that after the Order Carnivora appeared it split off into two suborders - "Feliformia"-(cat like) and "Caniformia" (dog like).
2) The species I have chosen for the Analogous trait comparison are frogs and ducks. Both frogs and ducks have webbed feet. Both of these animals are water animals. They rely on being able to use swimming as part of their transport and as a source of food. Being able to swim quickly is imperative to their survival. I couldn't find any link between them except for the widely known ideal that birds and reptiles are related. But a frog is not a reptile, it is an amphibian.
Bix...the angry cat. (He wears a pink collar because hes fabulous.)
2) The species I have chosen for the Analogous trait comparison are frogs and ducks. Both frogs and ducks have webbed feet. Both of these animals are water animals. They rely on being able to use swimming as part of their transport and as a source of food. Being able to swim quickly is imperative to their survival. I couldn't find any link between them except for the widely known ideal that birds and reptiles are related. But a frog is not a reptile, it is an amphibian.
Thursday, September 1, 2011
DNA Sequence
TACTAAGGCCTAAGTCTGTGAAACAGACGGTTAATC
some music for you to decode to....
Subscribe to:
Posts (Atom)

